Raras
Buscar doenças, sintomas, genes...
Coloboma da íris
ORPHA:98944CID-10 · Q13.0CID-11 · LA11.4DOENÇA RARA

Uma condição de nascença ou adquirida (que aparece depois), caracterizada pela presença de um furo na íris ou bem ao lado dela.

Mantido por Agente Raras·Colaborar como especialista →

Introdução

O que você precisa saber de cara

📋
Informacoes curadas por IA — podem conter imprecisoes

Uma condição de nascença ou adquirida (que aparece depois), caracterizada pela presença de um furo na íris ou bem ao lado dela.

Publicações científicas
34 artigos
Último publicado: 2024 Dec
🏥
SUS: Cobertura mínimaScore: 15%
CID-10: Q13.0
🇧🇷Dados SUS / DATASUS
PROCEDIMENTOS SIGTAP (5)
0202010503
Cariótipo — bandas G, Q ou Rgenetic_test
0202010600
Pesquisa de microdeleções/microduplicações por FISHlab_test
0202010694
Sequenciamento completo do exoma (WES)rehabilitation
0202010260
Dosagem de alfa-fetoproteína
0301070040
Atendimento em reabilitação — doenças raras
Você se identifica com essa condição?
O Raras está aqui pra te apoiar — com ou sem diagnóstico

Encontrou um erro ou informação desatualizada? Sugira uma correção →

Entender a doença

Do básico ao detalhe, leia no seu ritmo

Preparando trilha educativa...

Sinais e sintomas

O que aparece no corpo e com que frequência cada sintoma acontece

Linha do tempo da pesquisa

Publicações por ano — veja quando o interesse científico cresceu
Anos de pesquisa2desde 2024
Total histórico34PubMed
Últimos 10 anos8publicações
Pico20152 papers
Linha do tempo
2024Hoje · 2026🧪 2006Primeiro ensaio clínico
Publicações por ano (últimos 10 anos)

Encontrou um erro ou informação desatualizada? Sugira uma correção →

Genética e causas

O que está alterado no DNA e como passa nas famílias

Genes associados

5 genes identificados com associação a esta condição.

PAX6Paired box protein Pax-6Disease-causing germline mutation(s) inAltamente restrito
FUNÇÃO

Transcription factor with important functions in the development of the eye, nose, central nervous system and pancreas. Required for the differentiation of pancreatic islet alpha cells (By similarity). Competes with PAX4 in binding to a common element in the glucagon, insulin and somatostatin promoters. Regulates specification of the ventral neuron subtypes by establishing the correct progenitor domains (By similarity). Acts as a transcriptional repressor of NFATC1-mediated gene expression (By s

LOCALIZAÇÃO

Nucleus

VIAS BIOLÓGICAS (5)
Synthesis, secretion, and inactivation of Glucagon-like Peptide-1 (GLP-1)Regulation of gene expression in beta cellsActivation of anterior HOX genes in hindbrain development during early embryogenesisFormation of the anterior neural plateSynthesis, secretion, and inactivation of Glucose-dependent Insulinotropic Polypeptide (GIP)
MECANISMO DE DOENÇA

Aniridia 1

A congenital, bilateral, panocular disorder characterized by complete absence of the iris or extreme iris hypoplasia. Aniridia is not just an isolated defect in iris development but it is associated with macular and optic nerve hypoplasia, cataract, corneal changes, nystagmus. Visual acuity is generally low but is unrelated to the degree of iris hypoplasia. Glaucoma is a secondary problem causing additional visual loss over time.

EXPRESSÃO TECIDUAL(Tecido-específico)
Cérebro - Hemisfério cerebelar
40.8 TPM
Cerebelo
36.9 TPM
Córtex cerebral
3.5 TPM
Brain Caudate basal ganglia
3.4 TPM
Brain Anterior cingulate cortex BA24
3.3 TPM
OUTRAS DOENÇAS (17)
coloboma, ocular, autosomal dominantisolated optic nerve hypoplasiaautosomal dominant keratitisfoveal hypoplasia 1
HGNC:8620UniProt:P26367
SALL2Sal-like protein 2Disease-causing germline mutation(s) (loss of function) inTolerante
FUNÇÃO

Probable transcription factor that plays a role in eye development before, during, and after optic fissure closure

LOCALIZAÇÃO

Nucleus

MECANISMO DE DOENÇA

Coloboma, ocular, autosomal recessive

An ocular anomaly resulting from abnormal morphogenesis of the optic cup and stalk, and incomplete fusion of the fetal intra-ocular fissure during gestation. The clinical presentation is variable. Some individuals may present with minimal defects in the anterior iris leaf without other ocular defects. More complex malformations create a combination of iris, uveoretinal and/or optic nerve defects without or with microphthalmia or even anophthalmia.

EXPRESSÃO TECIDUAL(Ubíquo)
Cerebelo
88.2 TPM
Cérebro - Hemisfério cerebelar
83.7 TPM
Pituitária
26.7 TPM
Hipotálamo
22.9 TPM
Brain Nucleus accumbens basal ganglia
22.0 TPM
INTERAÇÕES PROTEICAS (2)
OUTRAS DOENÇAS (8)
coloboma, ocular, autosomal recessivecoloboma of maculacoloboma of iriscoloboma of eye lens
HGNC:10526UniProt:Q9Y467
ABCB6ATP-binding cassette sub-family B member 6Disease-causing germline mutation(s) inTolerante
FUNÇÃO

ATP-dependent transporter that catalyzes the transport of a broad-spectrum of porphyrins from the cytoplasm to the extracellular space through the plasma membrane or into the vesicle lumen (PubMed:17661442, PubMed:23792964, PubMed:27507172, PubMed:33007128). May also function as an ATP-dependent importer of porphyrins from the cytoplasm into the mitochondria, in turn may participate in the de novo heme biosynthesis regulation and in the coordination of heme and iron homeostasis during phenylhydr

LOCALIZAÇÃO

Cell membraneMitochondrion outer membraneEndoplasmic reticulum membraneGolgi apparatus membraneEndosome membraneLysosome membraneLate endosome membraneEarly endosome membraneSecreted, extracellular exosomeMitochondrionEndosome, multivesicular body membraneMelanosome membrane

VIAS BIOLÓGICAS (1)
Mitochondrial ABC transporters
MECANISMO DE DOENÇA

Microphthalmia/Coloboma 7

A disorder of eye formation, ranging from small size of a single eye to complete bilateral absence of ocular tissues. Ocular abnormalities like opacities of the cornea and lens, scaring of the retina and choroid, and other abnormalities may also be present. Ocular colobomas are a set of malformations resulting from abnormal morphogenesis of the optic cup and stalk, and the fusion of the fetal fissure (optic fissure).

OUTRAS DOENÇAS (12)
microphthalmia, isolated, with coloboma 7familial pseudohyperkalemiadyschromatosis universalis hereditaria 3obsolete blood group, langereis system
HGNC:47UniProt:Q9NP58
ACTG1Actin, cytoplasmic 2Disease-causing germline mutation(s) inModerado
FUNÇÃO

Actins are highly conserved proteins that are involved in various types of cell motility and are ubiquitously expressed in all eukaryotic cells. May play a role in the repair of noise-induced stereocilia gaps thereby maintains hearing sensitivity following loud noise damage (By similarity)

LOCALIZAÇÃO

Cytoplasm, cytoskeleton

VIAS BIOLÓGICAS (10)
Paradoxical activation of RAF signaling by kinase inactive BRAFSignaling by moderate kinase activity BRAF mutantsSignaling by high-kinase activity BRAF mutantsSignaling downstream of RAS mutantsMAP2K and MAPK activation
MECANISMO DE DOENÇA

Deafness, autosomal dominant, 20

A form of non-syndromic sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

OUTRAS DOENÇAS (6)
autosomal dominant nonsyndromic hearing loss 20Baraitser-winter syndrome 2Baraitser-Winter cerebrofrontofacial syndromecoloboma of iris
HGNC:144UniProt:P63261
FZD5Frizzled-5Disease-causing germline mutation(s) (gain of function) inAltamente restrito
FUNÇÃO

Receptor for Wnt proteins (PubMed:10097073, PubMed:20530549, PubMed:26908622, PubMed:9054360). Functions in the canonical Wnt/beta-catenin signaling pathway. In vitro activates WNT2, WNT10B, WNT5A, but not WNT2B or WNT4 signaling (By similarity). In neurons, activation by WNT7A promotes formation of synapses (PubMed:20530549). May be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues (Probable). Plays a rol

LOCALIZAÇÃO

Cell membraneGolgi apparatus membraneSynapsePerikaryonCell projection, dendriteCell projection, axon

VIAS BIOLÓGICAS (7)
Ca2+ pathwayAsymmetric localization of PCP proteinsWNT5A-dependent internalization of FZD2, FZD5 and ROR2Disassembly of the destruction complex and recruitment of AXIN to the membraneRegulation of FZD by ubiquitination
MECANISMO DE DOENÇA

Microphthalmia/Coloboma 11

A form of colobomatous microphthalmia, a disorder of eye formation, ranging from small size of a single eye to complete bilateral absence of ocular tissues. Ocular abnormalities like coloboma, opacities of the cornea and lens, scaring of the retina and choroid, and other abnormalities may also be present. Ocular colobomas are a set of malformations resulting from abnormal morphogenesis of the optic cup and stalk, and the fusion of the fetal fissure (optic fissure). MCOPCB11 is an autosomal dominant form with incomplete penetrance.

EXPRESSÃO TECIDUAL(Ubíquo)
Cólon transverso
27.6 TPM
Cólon sigmoide
18.0 TPM
Fígado
17.0 TPM
Tireoide
15.5 TPM
Estômago
13.4 TPM
OUTRAS DOENÇAS (7)
microphthalmia/coloboma 11coloboma of eyelidcoloboma of choroid and retinacoloboma of macula
HGNC:4043UniProt:Q13467

Variantes genéticas (ClinVar)

295 variantes patogênicas registradas no ClinVar.

🧬 FZD5: GRCh37/hg19 2q33.3-37.3(chr2:206965837-242783384)x3 ()
🧬 FZD5: NM_003468.4(FZD5):c.1603A>C (p.Ser535Arg) ()
🧬 FZD5: NM_003468.4(FZD5):c.986G>T (p.Ser329Ile) ()
🧬 FZD5: NM_003468.4(FZD5):c.395del (p.Ser132fs) ()
🧬 FZD5: NM_003468.4(FZD5):c.913A>G (p.Ile305Val) ()
Ver todas no ClinVar

Vias biológicas (Reactome)

43 vias biológicas associadas aos genes desta condição.

Regulation of gene expression in beta cells Synthesis, secretion, and inactivation of Glucagon-like Peptide-1 (GLP-1) Synthesis, secretion, and inactivation of Glucose-dependent Insulinotropic Polypeptide (GIP) Activation of anterior HOX genes in hindbrain development during early embryogenesis Formation of the anterior neural plate Mitochondrial ABC transporters Defective ABCB6 causes MCOPCB7 Translocation of SLC2A4 (GLUT4) to the plasma membrane Gap junction degradation Formation of annular gap junctions Regulation of actin dynamics for phagocytic cup formation EPHB-mediated forward signaling EPH-ephrin mediated repulsion of cells Adherens junctions interactions Recycling pathway of L1 VEGFA-VEGFR2 Pathway Interaction between L1 and Ankyrins Cell-extracellular matrix interactions RHO GTPases activate IQGAPs RHO GTPases Activate WASPs and WAVEs RHO GTPases Activate Formins MAP2K and MAPK activation Signaling by moderate kinase activity BRAF mutants Signaling by high-kinase activity BRAF mutants Signaling by BRAF and RAF1 fusions Paradoxical activation of RAF signaling by kinase inactive BRAF Clathrin-mediated endocytosis RHOBTB2 GTPase cycle Signaling downstream of RAS mutants Signaling by RAF1 mutants Sensory processing of sound by inner hair cells of the cochlea Sensory processing of sound by outer hair cells of the cochlea FCGR3A-mediated phagocytosis Regulation of CDH1 Function Formation of the dystrophin-glycoprotein complex (DGC) GBP-mediated host defense Class B/2 (Secretin family receptors) Ca2+ pathway Asymmetric localization of PCP proteins Disassembly of the destruction complex and recruitment of AXIN to the membrane Regulation of FZD by ubiquitination WNT5A-dependent internalization of FZD2, FZD5 and ROR2 Signaling by RNF43 mutants

Diagnóstico

Os sinais que médicos procuram e os exames que confirmam

Carregando...

Tratamento e manejo

Remédios, cuidados de apoio e o que precisa acompanhar

Pipeline de tratamentos
Pipeline regulatório — de medicamentos já aprovados a drogas em pesquisa exploratória.
·Pré-clínico1
Medicamentos catalogadosEnsaios clínicos· 0 medicamentos · 1 ensaio
Carregando informações de tratamento...

Onde tratar no SUS

Hospitais de referência no Brasil e o protocolo oficial do SUS (PCDT)

🇧🇷 Atendimento SUS — Coloboma da íris

🗺️

Selecione um estado ou use sua localização para ver resultados.

Dados de DATASUS/CNES, SBGM, ABNeuro e Ministério da Saúde. Sempre confirme a disponibilidade diretamente com o estabelecimento.

Pesquisa ativa

Ensaios clínicos abertos e novidades científicas recentes

Pesquisa e ensaios clínicos

1 ensaios clínicos encontrados.

Distribuição por fase
Ver todos no ClinicalTrials.gov
🧪 Está conduzindo uma pesquisa?
Divulgue para pacientes e familiares que acompanham esta doença.
Divulgar pesquisa →

Publicações mais relevantes

Timeline de publicações
8 papers (10 anos)
#1

Congenital bilateral coloboma of iris and choroid accompanied by unilateral multiple primary pigmented iris cysts: A case report.

International journal of surgery case reports2024 Dec

Congenital iris and choroidal coloboma is a congenital ocular developmental anomaly, most occur in both eyes, which may exist in isolation or be accompanied by systemic developmental abnormalities. Herein, we report a case of congenital bilateral coloboma of iris and choroid accompanied by unilateral multiple primary pigmented iris cysts. The selection of treatment methods for iris cysts has always been a challenge for ophthalmologists. Especially for primary iris pigment epithelial cysts without clinical symptoms, no particular intervention measures are required. Which in turn helps ophthalmologists to make clinical decisions in real-world practice. A 16-year-old boy presented to the ophthalmology clinic with a history of poor eyesight in both eyes since childhood. The pupils of both eyes were pear shaped, and there was a pigmented iris cyst about 1.5 mm × 2 mm at 6-7 o'clock pupillary margin of the left eye on slit-lamp examination. A large fan-shaped coloboma of choroid in both eyes respectively, involving the optic nerve and macular area on fundus examination. Ultrasound biomicroscopy revealed three cysts with hyperreflective walls and clear hyporeflective lumen in the left eye, one located on the anterior surface of the iris and the other two located on the posterior surface of the iris. Above all, he had no history of surgery, trauma, infection, tumor or medication. Therefore, primary pigmented iris epithelial cysts were diagnosed. Given that the patient was asymptomatic, with no impact on visual function, his cysts were monitored. After 2 years follow-up, the cysts remained stable. Iris cysts, whether primary or secondary, are a diagnostic and a treatment challenge. Primary iris cysts are mostly present in the iridociliary sulcus and the ciliary crown, often asymptomatic, with a few located forward or larger, manifested as local protrusions around the iris. This patient had no history of ocular surgery or trauma, therefore, combining clinical manifestations and imaging examination results, primary pigmented iris epithelial cysts were diagnosed. For this patient, on the one hand, the surgical risk was high, and iris cysts probably recur after surgery, and there might be no improvement in postoperative visual acuity. On the other hand, the patient's fundus was poor and his family's economic conditions were not good. In addition, the iris cysts of this patient remained stable after 2 years of observation, therefore, no treatment was taken. Ophthalmologists should be aware of this rare but distinctive presentation, especially in patients without symptoms. Prompt diagnosis and treatment are pivotal in ensuring favorable outcomes and preventing further ocular complications in individuals affected by these uveal anomalies.

#2

Phenotypic and cytogenetic variability of patau syndrome in Morocco.

African health sciences2023 Dec

The objective of this work was to identify phenotypic features and cytogenetic aspects of trisomy 13 in Moroccan population. The retrospective study was conducted on a group of 9 cases diagnosed cytogenetically with trisomy 13. The study of sex ratio showed a slight female dominance in our group of cases. The major clinical findings included: Holoprosencephaly, microphthalmia and anophthalmia, coloboma of iris, cleft lip and palate, nasal and ear abnormalities, retrognathism and sloping forehead, polydactyly, capillary hemangiomas, omphalocele, congenital heart defect, renal abnormalities, cryptorchidism, language delay. The cytogenetic study showed the dominance of the free and homogeneous trisomy 13 (56%). Patients who have this formula are dead at an early age (does not exceed one month). However, each of the chromosomal formula, trisomy 13 by translocation and partial trisomy 13 t (13;18), was found in 20% of our patients. The partial trisomy 13 t (13;18) is the only variant that is still alive and the patients with this anomaly suffer mainly from renal and cardiac anomalies with slight dysmorphia and psychomotor retardation. Our study shows the interest of the cytogenetic analysis in the diagnosis accuracy and in the genetic counseling of patients with Patau syndrome and their parents.

#3

[Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome].

Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics2021 Jan 10

To explore the genetic basis for three children patients with CHARGE syndrome. The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

#4

Evaluation of Posterior Ocular Structures in Patients with Isolated Iris Coloboma.

Beyoglu eye journal2020

To measure lamina cribrosa thickness (LCT), lamina cribrosa depth (LCD) and subfoveal choroidal thickness (SFCT) by imaging posterior ocular structures in pediatric cases with isolated unilateral iris coloboma and to investigate the differences as compared with healthy contralateral eyes of these cases (fellow eyes) and healthy control eyes. This cross-sectional, comparative prospective study included seven children (age range, 9-17 years) with unilateral isolated iris coloboma. The healthy contralateral eyes of these cases formed the fellow group. An age-matched (age range 8-17 years) control group (n=9), including children with both eyes having either normal or corrected-to-normal visual acuity, was formed. A detailed ophthalmic examination was performed. The posterior ocular segments were evaluated using spectral domain-optical coherence tomography (SD-OCT) with enhanced depth imaging (EDI) technique. The SFCT was 372.0±48.8 µm, 375.3±44.0 µm, and 386.5±71.8 µm, respectively, and the LCD was 362.4±68.3 µm, 354.4±47.1 µm, and 350.7±38.1 µm, respectively, in the coloboma, fellow, and control eyes. There was no difference between the groups regarding SFCT and LCD. The mean LCT was significantly thinner in the coloboma eyes (200.2±9.5 µm) than in the fellow (238.8±26.7 µm; p=0.023) and control eyes (240.0±12.9 µm; p<0.001). The LCT showed no significant correlation with age, axial length or spherical equivalent. Better visual prognosis is expected in isolated iris coloboma. However, detailed examinations using new technologies, such as SD-OCT, may reveal some structural changes. Longitudinal studies are required to understand if a thinner LCT in coloboma eyes is associated with any future problems.

#5

Sequence variations in TENM3 gene causing eye anomalies with intellectual disability: Expanding the phenotypic spectrum.

European journal of medical genetics2019 Jan

Microphthalmia, anophthalmia are the malformations of the eye, referring to a congenital absence, and a reduced size of the eyeball. Coloboma of iris is associated with many of the cases. Here, we report a propositus with eye anomalies and intellectual disability associated with TENM3 pathogenic variations identified by exome sequencing and confirms intellectual disability as a phenotype associated with TENM3 variations. This child was compound heterozygote [NM_001080477.3(TENM3):c.4046C > G; p.(Ala1349Gly) and NM_001080477.3(TENM3): c.7687C > T; p.(Arg2563Trp)] for the missense likely pathogenic sequence variations in TENM3 gene. To our knowledge only three patients till now have been reported to have TENM3 pathogenic variations in association with microphthalmia, two siblings without developmental delay and third with developmental delay. This report supports the association of TENM3 variations with colobomatous microphthalmia and expands the phenotypic spectrum associated with pathogenic variations in this gene.

Publicações recentes

Ver todas no PubMed

Associações

Organizações que acompanham esta doença — pra ter apoio e orientação

Ainda não temos associações cadastradas para Coloboma da íris.

É de uma associação que acompanha esta doença? Fale com a gente →

Comunidades

Grupos ativos de quem convive com esta doença aqui no Raras

Ainda não existe comunidade no Raras para Coloboma da íris

Pacientes, familiares e cuidadores se organizam em comunidades pra compartilhar experiências, fazer perguntas e se apoiar. Você pode ser o primeiro.

Tire suas dúvidas

Perguntas, dicas e experiências compartilhadas aqui na página

Participe da discussão

Faça login para postar dúvidas, compartilhar experiências e interagir com especialistas.

Fazer login

Doenças relacionadas

Doenças com sintomas parecidos — ajudam quem ainda está buscando diagnóstico

Ainda não achamos doenças com sintomas parecidos o suficiente.

Referências e fontes

Bases de dados externas citadas neste artigo

Publicações científicas

Artigos indexados no PubMed ligados a esta doença no grafo RarasNet — título, periódico e PMID direto da fonte, sem intermediação de IA.

  1. Congenital bilateral coloboma of iris and choroid accompanied by unilateral multiple primary pigmented iris cysts: A case report.
    International journal of surgery case reports· 2024· PMID 39550813mais citado
  2. Phenotypic and cytogenetic variability of patau syndrome in Morocco.
    African health sciences· 2023· PMID 38974285mais citado
  3. [Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome].
    Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics· 2021· PMID 33423256mais citado
  4. Evaluation of Posterior Ocular Structures in Patients with Isolated Iris Coloboma.
    Beyoglu eye journal· 2020· PMID 35098094mais citado
  5. Sequence variations in TENM3 gene causing eye anomalies with intellectual disability: Expanding the phenotypic spectrum.
    European journal of medical genetics· 2019· PMID 29753094mais citado

Bases de dados e fontes oficiais

Identificadores e referências canônicas usadas para montar este verbete.

  1. ORPHA:98944(Orphanet)
  2. MONDO:0020356(MONDO)
  3. GARD:1434(GARD (NIH))
  4. Variantes catalogadas(ClinVar)
  5. Busca completa no PubMed(PubMed)
  6. Q56014419(Wikidata)

Dados compilados pelo RarasNet a partir de fontes abertas (Orphanet, OMIM, MONDO, PubMed/EuropePMC, ClinicalTrials.gov, DATASUS, PCDT/MS). Este conteúdo é informativo e não substitui avaliação médica.

Conteúdo mantido por Agente Raras · Médicos e pesquisadores podem colaborar

Coloboma da íris
Compêndio · Raras BR

Coloboma da íris

ORPHA:98944 · MONDO:0020356
CID-10
Q13.0 · Coloboma da íris
CID-11
MedGen
UMLS
C0240063
EuropePMC
Wikidata
Papers 10a
DiscussaoAtiva

Nenhuma novidade ainda. O agente esta monitorando.

0membros
0novidades

📋 Origem dos dados

Esta página agrega dados de fontes públicas e oficiais. Dados sobre cobertura no SUS (PCDT, CEAF) são verificados ativamente por agente proativo (ver badge no infobox). Demais dados têm atribuição de fonte + data da última sincronização — clique para abrir o original.

Doença rara (ontologia)
fonte: Orphanet
Identificador unificado
fonte: MONDO
Dado público estruturado
fonte: Wikidata