Congenital iris and choroidal coloboma is a congenital ocular developmental anomaly, most occur in both eyes, which may exist in isolation or be accompanied by systemic developmental abnormalities. Herein, we report a case of congenital bilateral coloboma of iris and choroid accompanied by unilateral multiple primary pigmented iris cysts. The selection of treatment methods for iris cysts has always been a challenge for ophthalmologists. Especially for primary iris pigment epithelial cysts without clinical symptoms, no particular intervention measures are required. Which in turn helps ophthalmologists to make clinical decisions in real-world practice. A 16-year-old boy presented to the ophthalmology clinic with a history of poor eyesight in both eyes since childhood. The pupils of both eyes were pear shaped, and there was a pigmented iris cyst about 1.5 mm × 2 mm at 6-7 o'clock pupillary margin of the left eye on slit-lamp examination. A large fan-shaped coloboma of choroid in both eyes respectively, involving the optic nerve and macular area on fundus examination. Ultrasound biomicroscopy revealed three cysts with hyperreflective walls and clear hyporeflective lumen in the left eye, one located on the anterior surface of the iris and the other two located on the posterior surface of the iris. Above all, he had no history of surgery, trauma, infection, tumor or medication. Therefore, primary pigmented iris epithelial cysts were diagnosed. Given that the patient was asymptomatic, with no impact on visual function, his cysts were monitored. After 2 years follow-up, the cysts remained stable. Iris cysts, whether primary or secondary, are a diagnostic and a treatment challenge. Primary iris cysts are mostly present in the iridociliary sulcus and the ciliary crown, often asymptomatic, with a few located forward or larger, manifested as local protrusions around the iris. This patient had no history of ocular surgery or trauma, therefore, combining clinical manifestations and imaging examination results, primary pigmented iris epithelial cysts were diagnosed. For this patient, on the one hand, the surgical risk was high, and iris cysts probably recur after surgery, and there might be no improvement in postoperative visual acuity. On the other hand, the patient's fundus was poor and his family's economic conditions were not good. In addition, the iris cysts of this patient remained stable after 2 years of observation, therefore, no treatment was taken. Ophthalmologists should be aware of this rare but distinctive presentation, especially in patients without symptoms. Prompt diagnosis and treatment are pivotal in ensuring favorable outcomes and preventing further ocular complications in individuals affected by these uveal anomalies.

The objective of this work was to identify phenotypic features and cytogenetic aspects of trisomy 13 in Moroccan population. The retrospective study was conducted on a group of 9 cases diagnosed cytogenetically with trisomy 13. The study of sex ratio showed a slight female dominance in our group of cases. The major clinical findings included: Holoprosencephaly, microphthalmia and anophthalmia, coloboma of iris, cleft lip and palate, nasal and ear abnormalities, retrognathism and sloping forehead, polydactyly, capillary hemangiomas, omphalocele, congenital heart defect, renal abnormalities, cryptorchidism, language delay. The cytogenetic study showed the dominance of the free and homogeneous trisomy 13 (56%). Patients who have this formula are dead at an early age (does not exceed one month). However, each of the chromosomal formula, trisomy 13 by translocation and partial trisomy 13 t (13;18), was found in 20% of our patients. The partial trisomy 13 t (13;18) is the only variant that is still alive and the patients with this anomaly suffer mainly from renal and cardiac anomalies with slight dysmorphia and psychomotor retardation. Our study shows the interest of the cytogenetic analysis in the diagnosis accuracy and in the genetic counseling of patients with Patau syndrome and their parents.

To explore the genetic basis for three children patients with CHARGE syndrome. The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

To measure lamina cribrosa thickness (LCT), lamina cribrosa depth (LCD) and subfoveal choroidal thickness (SFCT) by imaging posterior ocular structures in pediatric cases with isolated unilateral iris coloboma and to investigate the differences as compared with healthy contralateral eyes of these cases (fellow eyes) and healthy control eyes. This cross-sectional, comparative prospective study included seven children (age range, 9-17 years) with unilateral isolated iris coloboma. The healthy contralateral eyes of these cases formed the fellow group. An age-matched (age range 8-17 years) control group (n=9), including children with both eyes having either normal or corrected-to-normal visual acuity, was formed. A detailed ophthalmic examination was performed. The posterior ocular segments were evaluated using spectral domain-optical coherence tomography (SD-OCT) with enhanced depth imaging (EDI) technique. The SFCT was 372.0±48.8 µm, 375.3±44.0 µm, and 386.5±71.8 µm, respectively, and the LCD was 362.4±68.3 µm, 354.4±47.1 µm, and 350.7±38.1 µm, respectively, in the coloboma, fellow, and control eyes. There was no difference between the groups regarding SFCT and LCD. The mean LCT was significantly thinner in the coloboma eyes (200.2±9.5 µm) than in the fellow (238.8±26.7 µm; p=0.023) and control eyes (240.0±12.9 µm; p<0.001). The LCT showed no significant correlation with age, axial length or spherical equivalent. Better visual prognosis is expected in isolated iris coloboma. However, detailed examinations using new technologies, such as SD-OCT, may reveal some structural changes. Longitudinal studies are required to understand if a thinner LCT in coloboma eyes is associated with any future problems.

Microphthalmia, anophthalmia are the malformations of the eye, referring to a congenital absence, and a reduced size of the eyeball. Coloboma of iris is associated with many of the cases. Here, we report a propositus with eye anomalies and intellectual disability associated with TENM3 pathogenic variations identified by exome sequencing and confirms intellectual disability as a phenotype associated with TENM3 variations. This child was compound heterozygote [NM_001080477.3(TENM3):c.4046C > G; p.(Ala1349Gly) and NM_001080477.3(TENM3): c.7687C > T; p.(Arg2563Trp)] for the missense likely pathogenic sequence variations in TENM3 gene. To our knowledge only three patients till now have been reported to have TENM3 pathogenic variations in association with microphthalmia, two siblings without developmental delay and third with developmental delay. This report supports the association of TENM3 variations with colobomatous microphthalmia and expands the phenotypic spectrum associated with pathogenic variations in this gene.