Raras
Buscar doenças, sintomas, genes...
Ictiose epidermolítica anular
ORPHA:281139CID-10 · Q80.3CID-11 · EC20.03PCDT · SUSDOENÇA RARA

A ictiose epidermolítica anular (AEI) é uma variante clínica rara da ictiose epidermolítica (EI) caracterizada pela presença de um fenótipo bolhoso ao nascimento e pelo desenvolvimento, desde a primeira infância, de escamas eritematosas policíclicas anulares no tronco e nas extremidades.

Mantido por Agente Raras·Colaborar como especialista →

Introdução

O que você precisa saber de cara

📋

A ictiose epidermolítica anular (AEI) é uma variante clínica rara da ictiose epidermolítica (EI) caracterizada pela presença de um fenótipo bolhoso ao nascimento e pelo desenvolvimento, desde a primeira infância, de escamas eritematosas policíclicas anulares no tronco e nas extremidades.

Publicações científicas
14 artigos
Último publicado: 2022 Feb 24

Escala de raridade

CLASSIFICAÇÃO ORPHANET · BRASIL 2024
<1 / 1 000 000
Ultra-rara
<1/50k
Muito rara
1/20k
Rara
1/10k
Pouco freq.
1/5k
Incomum
1/2k
Prevalência
0.0
Worldwide
Casos conhecidos
7
pacientes catalogados
Início
Infancy
+ neonatal
🏥
SUS: Cobertura parcialScore: 45%
PCDT disponívelCID-10: Q80.3
🇧🇷Dados SUS / DATASUS
PROCEDIMENTOS SIGTAP (5)
0202010503
Cariótipo — bandas G, Q ou Rgenetic_test
0202010600
Pesquisa de microdeleções/microduplicações por FISHlab_test
0202010694
Sequenciamento completo do exoma (WES)rehabilitation
0202010260
Dosagem de alfa-fetoproteína
0301070040
Atendimento em reabilitação — doenças raras
Você se identifica com essa condição?
O Raras está aqui pra te apoiar — com ou sem diagnóstico

Encontrou um erro ou informação desatualizada? Sugira uma correção →

Entender a doença

Do básico ao detalhe, leia no seu ritmo

Preparando trilha educativa...

Sinais e sintomas

O que aparece no corpo e com que frequência cada sintoma acontece

Características mais comuns

Hiperparaqueratose
Morfologia anormal da unha
Anormalidade do cabelo
Eritrodermia ictiosiforme bolhosa congênita
Liquenificação flexural
Placa eritematosa
14sintomas
Sem dados (14)

Os sintomas variam de pessoa para pessoa. Abaixo estão as 14 características clínicas mais associadas, ordenadas por frequência.

HiperparaqueratoseHyperparakeratosis
Morfologia anormal da unhaAbnormality of the nail
Anormalidade do cabeloAbnormality of the hair
Eritrodermia ictiosiforme bolhosa congênitaCongenital bullous ichthyosiform erythroderma
Liquenificação flexuralFlexural lichenification

Linha do tempo da pesquisa

Publicações por ano — veja quando o interesse científico cresceu
Anos de pesquisa4desde 2022
Total histórico14PubMed
Últimos 10 anos7publicações
Pico20203 papers
Linha do tempo
2022Hoje · 2026📈 2020Ano de pico
Publicações por ano (últimos 10 anos)

Encontrou um erro ou informação desatualizada? Sugira uma correção →

Genética e causas

O que está alterado no DNA e como passa nas famílias

Genes associados

2 genes identificados com associação a esta condição. Padrão de herança: Autosomal dominant.

KRT10Keratin, type I cytoskeletal 10Disease-causing germline mutation(s) inTolerante
FUNÇÃO

Plays a role in the establishment of the epidermal barrier on plantar skin (By similarity). Involved in the maintenance of cell layer development and keratin filament bundles in suprabasal cells of the epithelium (By similarity) (Microbial infection) Acts as a mediator of S.aureus adherence to desquamated nasal epithelial cells via clfB, and hence may play a role in nasal colonization (Microbial infection) Binds S.pneumoniae PsrP, mediating adherence of the bacteria to lung cell lines. Reduction

LOCALIZAÇÃO

Secreted, extracellular spaceCell surfaceCytoplasm

VIAS BIOLÓGICAS (3)
KeratinizationFormation of the cornified envelopeDifferentiation of Keratinocytes in Interfollicular Epidermis in Mammalian Skin
MECANISMO DE DOENÇA

Epidermolytic hyperkeratosis 2A

An autosomal dominant form of epidermolytic hyperkeratosis, a skin disorder characterized by widespread blistering and an ichthyotic erythroderma at birth that persist into adulthood. Histologically there is a diffuse epidermolytic degeneration in the lower spinous layer of the epidermis. Within a few weeks from birth, erythroderma and blister formation diminish and hyperkeratoses develop. EHK2 inheritance is autosomal dominant or autosomal recessive.

EXPRESSÃO TECIDUAL(Ubíquo)
Skin Sun Exposed Lower leg
24040.3 TPM
Skin Not Sun Exposed Suprapubic
20396.5 TPM
Vagina
168.0 TPM
Testículo
52.4 TPM
Pituitária
43.2 TPM
OUTRAS DOENÇAS (8)
congenital reticular ichthyosiform erythrodermaepidermolytic hyperkeratosis 2B, autosomal recessiveepidermolytic hyperkeratosis 2A, autosomal dominantichthyosis, annular epidermolytic 1
HGNC:6413UniProt:P13645
KRT1Keratin, type II cytoskeletal 1Disease-causing germline mutation(s) inTolerante
FUNÇÃO

May regulate the activity of kinases such as PKC and SRC via binding to integrin beta-1 (ITB1) and the receptor of activated protein C kinase 1 (RACK1). In complex with C1QBP is a high affinity receptor for kininogen-1/HMWK

LOCALIZAÇÃO

Cell membraneCytoplasm

VIAS BIOLÓGICAS (1)
Neutrophil degranulation
MECANISMO DE DOENÇA

Epidermolytic hyperkeratosis 1

A skin disorder characterized by widespread blistering and an ichthyotic erythroderma at birth that persist into adulthood. Histologically there is a diffuse epidermolytic degeneration in the lower spinous layer of the epidermis. Within a few weeks from birth, erythroderma and blister formation diminish and hyperkeratoses develop. EHK1 inheritance is autosomal dominant or autosomal recessive.

EXPRESSÃO TECIDUAL(Ubíquo)
Skin Not Sun Exposed Suprapubic
15625.5 TPM
Skin Sun Exposed Lower leg
14326.1 TPM
Vagina
330.1 TPM
Sangue
16.1 TPM
Esôfago - Mucosa
12.8 TPM
OUTRAS DOENÇAS (12)
diffuse nonepidermolytic palmoplantar keratodermakeratosis palmoplantaris striata 3ichthyosis hystrix of Curth-Macklinpalmoplantar keratoderma, epidermolytic, 2
HGNC:6412UniProt:P04264

Variantes genéticas (ClinVar)

129 variantes patogênicas registradas no ClinVar.

🧬 KRT10: NM_000421.5(KRT10):c.462T>A (p.Asn154Lys) ()
🧬 KRT10: NM_000421.5(KRT10):c.1370G>T (p.Gly457Val) ()
🧬 KRT10: GRCh37/hg19 17q12-21.2(chr17:33220181-39572233)x3 ()
🧬 KRT10: NM_000421.5(KRT10):c.359G>A (p.Gly120Asp) ()
🧬 KRT10: NM_000421.5(KRT10):c.1209_1210delinsTT (p.Gln403_Leu404delinsHisPhe) ()
Ver todas no ClinVar

Classificação de variantes (ClinVar)

Distribuição de 12 variantes classificadas pelo ClinVar.

9
3
Patogênica (75.0%)
Benigna (25.0%)
VARIANTES MAIS SIGNIFICATIVAS
KRT10-AS1: NM_000421.5(KRT10):c.470T>G (p.Leu157Arg) [Likely pathogenic]
KRT10: NM_000421.5(KRT10):c.49GGA[9] (p.Gly24dup) [Conflicting classifications of pathogenicity]
KRT10: NM_000421.5(KRT10):c.1654AGCTCCGGCGGCGGATACGGCGGCGGCAGC[3] (p.556GYGGGSSSGG[3]) [Conflicting classifications of pathogenicity]
KRT1: NM_006121.4(KRT1):c.564C>G (p.Asn188Lys) [Likely pathogenic]
KRT1: NM_006121.4(KRT1):c.532T>C (p.Ser178Pro) [Likely pathogenic]

Diagnóstico

Os sinais que médicos procuram e os exames que confirmam

Carregando...

Tratamento e manejo

Remédios, cuidados de apoio e o que precisa acompanhar

Carregando informações de tratamento...

Onde tratar no SUS

Hospitais de referência no Brasil e o protocolo oficial do SUS (PCDT)

🇧🇷 Atendimento SUS — Ictiose epidermolítica anular

🗺️

Selecione um estado ou use sua localização para ver resultados.

Dados de DATASUS/CNES, SBGM, ABNeuro e Ministério da Saúde. Sempre confirme a disponibilidade diretamente com o estabelecimento.

Pesquisa ativa

Ensaios clínicos abertos e novidades científicas recentes

Pesquisa e ensaios clínicos

Nenhum ensaio clínico registrado para esta condição.

🧪 Está conduzindo uma pesquisa?
Divulgue para pacientes e familiares que acompanham esta doença.
Divulgar pesquisa →

Publicações mais relevantes

Timeline de publicações
7 papers (10 anos)
#1

Annular Epidermolytic Ichthyosis Mimicking Greither Disease: A Case Report and Literature Review.

The American journal of case reports2022 Feb 24

BACKGROUND Annular epidermolytic ichthyosis is a rare form of epidermolytic ichthyosis caused by specific pathogenic variants of KRT1 and KRT10. Classically, it manifests at birth with variable degrees of erythroderma and superficial erosions, which subsequently improve with time. Later, it is characterized by a cyclic history of annular hyperkeratotic erythematous plaques over the trunk and proximal extremities, with or without palmoplantar keratoderma. Greither syndrome, another autosomal dominant disorder of KRT1 mutation, is demonstrated by the diffuse, thick, scaly yellow PPK with transgrediens and erythematous border extending up to the Achilles' tendon, patchy hyperkeratotic plaques over the knees, shins, thighs, elbows, knuckles, and axillary folds. We describe a patient with clinical findings consistent with annular epidermolytic ichthyosis mimicking Greither disease with a likely associated pathogenic variant of KRT1. CASE REPORT A 3-year-old Saudi girl presented with a diffuse palmoplantar keratoderma (PPK) extending to the dorsal aspects of the hands and feet up to the Achilles' tendon, first noticed at the age of 3 months, with a history of recurrent coin-shaped erythematous crusted erosions over the trunk, which were spontaneously healed over time, and an associated history of hyperhidrosis. Patchy hyperkeratotic plaques were noticed upon further examination over the bilateral elbows, axillary folds, and oral commissures. CONCLUSIONS The phenotype of our patient is consistent with the clinical features described for AEI, making the new K1 variant a likely pathogenic variant. When K1 mutation is the causative variant of the disease expression, phenotypically, it can present with Greither-like PPK.

#2

A Case of Annular Epidermolytic Ichthyosis Resulting from a de Novo Mutation, p.I479T, in Keratin 1 Gene.

Indian journal of dermatology2021

We report a case of annular epidermolytic ichthyosis (AEI) resulting from de novo keratin 1 gene mutation. AEI is a rare autosomal dominantly inherited cornification disorder and is a distinct phenotypic variant of bullous congenital ichthyosiform erythroderma. Blisters and erosions in AEI are widespread; hence, initially, it is sometimes mistaken with epidermolysis bullosa, acrodermatitis enteropathica, and staphylococcal scalded skin syndrome. Genetic tests including next-generation sequencing and Sanger sequencing are essential for AEI diagnosis. AEI is treated symptomatically by wound dressing, prevention of infection, and the use of emollients, humectants, and keratolytic products; topical or systemic retinoids may also prove helpful.

#3

Annular epidermolytic ichthyosis with palmoplantar keratosis: a unique phenotype associated with interfamilial phenotypic heterogeneity.

European journal of dermatology : EJD2020 Jun 01

Annular epidermolytic ichthyosis (AEI) is a rare autosomal dominant ichthyosis that was recently described in 10 separate families in the English literature. There are no reports on the phenotypic heterogeneity of AEI. We investigated, for the first time, a large Chinese AEI pedigree exhibiting interfamilial phenotypic heterogeneity. We collected clinical data and DNA from the members of the family, and skin lesions were obtained from two patients with different phenotypes. Skin imaging examinations were performed. Whole-exome sequencing (WES) and Sanger sequencing were used to detect gene mutations. The characteristic features of granular layer degeneration in the two biopsies were verified via histological methods. The missense mutation c.1436T > C in KRT1 was detected in all nine patients. This study demonstrates that AEI may present with different clinical phenotypes and that mutation analysis for suspected cases is necessary to obtain a precise diagnosis.

#4

Annular epidermolytic ichthyosis: a case report and literature review.

Anais brasileiros de dermatologia2020

Annular epidermolytic ichthyosis is a rare subtype of epidermolytic ichthyosis that is characterized by erythematous, polycyclic, and migratory scaly plaques accompanied by palmoplantar keratoderma. This report presents the case of an 8-year-old girl who developed migratory, erythematous, scaly plaques associated with palmoplantar keratoderma. The initial hypothesis was erythrokeratodermia variabilis et progressiva; however, the finding of epidermolytic hyperkeratosis in histopathological examination led to the diagnosis of annular epidermolytic ichthyosis.

#5

Annular epidermolytic ichthyosis: An exceptional mild subtype of epidermolytic ichthyosis without genotype and phenotype correlation.

JAAD case reports2020 Jan

Publicações recentes

Ver todas no PubMed

Associações

Organizações que acompanham esta doença — pra ter apoio e orientação

Ainda não temos associações cadastradas para Ictiose epidermolítica anular.

É de uma associação que acompanha esta doença? Fale com a gente →

Comunidades

Grupos ativos de quem convive com esta doença aqui no Raras

Ainda não existe comunidade no Raras para Ictiose epidermolítica anular

Pacientes, familiares e cuidadores se organizam em comunidades pra compartilhar experiências, fazer perguntas e se apoiar. Você pode ser o primeiro.

Tire suas dúvidas

Perguntas, dicas e experiências compartilhadas aqui na página

Participe da discussão

Faça login para postar dúvidas, compartilhar experiências e interagir com especialistas.

Fazer login

Doenças relacionadas

Doenças com sintomas parecidos — ajudam quem ainda está buscando diagnóstico

Referências e fontes

Bases de dados externas citadas neste artigo

Publicações científicas

Artigos indexados no PubMed ligados a esta doença no grafo RarasNet — título, periódico e PMID direto da fonte, sem intermediação de IA.

  1. Annular Epidermolytic Ichthyosis Mimicking Greither Disease: A Case Report and Literature Review.
    The American journal of case reports· 2022· PMID 35202349mais citado
  2. A Case of Annular Epidermolytic Ichthyosis Resulting from a de Novo Mutation, p.I479T, in Keratin 1 Gene.
    Indian journal of dermatology· 2021· PMID 34188299mais citado
  3. Annular epidermolytic ichthyosis with palmoplantar keratosis: a unique phenotype associated with interfamilial phenotypic heterogeneity.
    European journal of dermatology : EJD· 2020· PMID 32666929mais citado
  4. Annular epidermolytic ichthyosis: a case report and literature review.
    Anais brasileiros de dermatologia· 2020· PMID 32482553mais citado
  5. Annular epidermolytic ichthyosis: An exceptional mild subtype of epidermolytic ichthyosis without genotype and phenotype correlation.
    JAAD case reports· 2020· PMID 31909138mais citado

Bases de dados e fontes oficiais

Identificadores e referências canônicas usadas para montar este verbete.

  1. ORPHA:281139(Orphanet)
  2. MONDO:0011870(MONDO)
  3. Ictiose Hereditaria(PCDT · Ministério da Saúde)
  4. GARD:17304(GARD (NIH))
  5. Variantes catalogadas(ClinVar)
  6. Busca completa no PubMed(PubMed)
  7. Q55999744(Wikidata)

Dados compilados pelo RarasNet a partir de fontes abertas (Orphanet, OMIM, MONDO, PubMed/EuropePMC, ClinicalTrials.gov, DATASUS, PCDT/MS). Este conteúdo é informativo e não substitui avaliação médica.

Conteúdo mantido por Agente Raras · Médicos e pesquisadores podem colaborar

Ictiose epidermolítica anular
Compêndio · Raras BR

Ictiose epidermolítica anular

ORPHA:281139 · MONDO:0011870
🇧🇷 Brasil SUS
Geral
Prevalência
<1 / 1 000 000
Casos
7 casos conhecidos
Herança
Autosomal dominant
CID-10
Q80.3 · Eritrodermia ictiosiforme bulhosa congênita
CID-11
Início
Infancy, Neonatal
Prevalência
0.0 (Worldwide)
MedGen
UMLS
C1843463
EuropePMC
Wikidata
Papers 10a
DiscussaoAtiva

Nenhuma novidade ainda. O agente esta monitorando.

0membros
0novidades