Defects in thyroid hormone synthesis at birth lead to congenital hypothyroidism (CH). Recently, pathogenic variants in the SLC26A7 gene have been linked to dyshormonogenetic goitrous CH. This anion transporter is highly expressed in the thyroid and is involved in thyroid hormone synthesis; however, its exact function and cellular localization remain unclear. In this study, we investigated SLC26A7 variants in Finnish patients with CH, characterized the phenotypes, and analyzed thyroid-specific gene expression. SLC26A7 variants were identified from a clinical CH cohort (n = 139) using exome sequencing, and the FinnGen database (R12 release) was screened for disease associations. Thyroid histology and thyroid-specific gene expression were analyzed in six human samples (including two homozygous SLC26A7 pathogenic variant carriers, patients with goitrous and hyperactive thyroids, and normal controls) and in thyroids from different mouse models (including hypo- and hyperthyroid mice, thyroid-specific G-protein deficient, and Slc26a7-knockout mice). Four CH patients from four novel families carried the homozygous SLC26A7 (c.1893delT, p.F631Lfs*8) pathogenic variant. Two had large trachea-compressing goiters, requiring thyroidectomy already at birth. In addition, one homozygous participant with normal CH screening results developed hypothyroidism at age 16, and one patient with heterozygous SLC26A7 pathogenic variant had permanent CH at birth. Dentofacial abnormalities were frequently noted, including enamel hypoplasia (in four carriers), pro- or retrognathia, and malocclusion requiring orthodontic treatment (in 8/24 carriers). Thyrocyte hypertrophy with large colloid aggregates was a hallmark of homozygous patients. FinnGen screening revealed a 75-fold enrichment of the variant in the Finnish population, identifying a few other homozygous and seven heterozygous cases with early-onset hypothyroidism and dentofacial abnormalities. In human thyrocytes, SLC26A7 was localized to the basolateral membrane, with intense staining in hyperthyroid samples, while in mouse thyroid models, its expression pattern depended on dietary iodide levels, thyrotropin signaling, and GNAS activity. We describe variable phenotypes associated with the SLC26A7 pathogenic variant, ranging from severe CH with large congenital goiters to delayed onset hypothyroidism and dentofacial abnormalities. SLC26A7 shows thyrotropin-, GNAS-, and dietary iodine-dependent basolateral localization, suggesting their role in phenotypic variations.

Congenital hypothyroidism (CH) is a leading cause of preventable intellectual disability worldwide if left untreated. Thyroid peroxidase (TPO) is a key enzyme that uses hydrogen peroxide from the DUOX/DUOXA system to oxidize iodide for thyroid hormone synthesis. This work aimed to identify the pathogenic TPO variants responsible for CH. Variants identified by whole-exome sequencing were analyzed using in silico tools and structural modeling for pathogenicity. TPO function was assessed through in vitro studies on intracellular trafficking, enzymatic activity, and interaction with DUOX/DUOXA proteins. Six TPO variants were identified: p.G395D, p.V618M, p.M706V, and p.T725P in family 1, and p.R648G and p.G771R in families 2 and 3, respectively. Affected individuals in family 1 exhibited compound heterozygous or homozygous variants for the 4 variants. In silico analyses showed incomplete concordance in predicting pathogenicity. In vitro studies confirmed p.G395D as the primary pathogenic variant in family 1, and p.R648G and p.G771R in families 2 and 3. Notably, p.V618M, p.M706V, and p.T725P did not impair TPO function, either individually or in combination, suggesting that these regions are not critical for enzymatic activity. Further functional analyses revealed that p.G771R is essential for proper membrane insertion, whereas p.R648G is necessary for enzymatic activity. When multiple TPO variants occur within the same family, a combination of in silico and in vitro analyses can help identify the variant responsible for the phenotype. In silico methods, however, cannot predict the different mechanisms of impairment, such as enzyme activity vs cellular localization, where the protein's topology is essential for normal function.

Pathogenic variants in the genes involved in the formation of thyroid tissue and thyroid hormone secretion have been reported to cause congenital hypothyroidism (CH) in some cases. This study aimed to evaluate the clinical and genetic findings of CH cases thought to be due to genetic variants. The study included cases whose genetic analysis was performed in accordance with the Congenital Hypothyroidism: A 2020-2021 Consensus Guidelines Update Guidelines recommendations criteria and analyzed them using the next-generation sequencing panel. Sixty one Turkish patients from 45 families were included in the study. The overall frequency of variant detection was 37.7% (out of 45 families, 17 had a positive mutation). Segregation was carried out for all families with positive variants. Variants in the TPO gene are the most frequently encountered, and this situation was identified in 10 families. Variants followed this in the TSHR gene in 7 families, variants in the DUOX2 gene in 5 families, and two variants in the TG and NKX2-1 genes in 2 families each, which are six novel variants. Furthermore, among the NKX2-1 cases, one had thyroid involvement only, while the other had chorea only. We did not find differences between cases with detected mutations and mutation-negative cases regarding gender, neonatal/perinatal parameters, initial thyroid function values, and thyroid morphology. In the current investigation, rare new variations in genes known to be related to CH were discovered, adding to the molecular genetic spectrum. When we compare the overall variant detection frequency, the selection criterion for genetic analysis based on the current guidelines is quite rational, considering the benefits and costs, on the other hand, present in new genes awaiting discovery. Also, TSHR mutations are likely to be common and may account for more than 5% of thyroid dysgenesis cases if we include nonfamilial thyroid dysgenesis.

Rafiq syndrome is a rare autosomal recessive genetic disorder first described by Rafiq et al. in 2011.With an extremely low incidence rate, just over 40 cases have been reported worldwide. This condition is caused by mutations in the MAN1B1 gene, which encodes a member of the glycosyl hydrolase family 47.The primary clinical features of Rafiq syndrome include intellectual and motor developmental delay, distinctive facial features, truncal obesity, and hypotonia. We described a case of Rafiq syndrome with coexisting thyroid dyshormonogenesis type 6 in a Chinese Patient. The patient presented with distinctive facial features (small forehead, wide eye distance, small bilateral eye fissures, low nose bridge, protruding nose, short philtrum, small chin, large ears, short neck), borderline intellectual delay, truncal obesity, abnormal coagulation function, abnormal electroencephalogram, which were similar with the clinical manifestations of Rafiq syndrome reported in the literature. In addition to the above-mentioned abnormalities, the child also has thyroid dyshormonogenesis type 6. Genetic testing has identified compound heterozygous mutations in the MAN1B1 gene: c.1281_1303delCATCCACGCCTGTGTCTGGAAGA and c.2011C>T, and one heterozygous mutation in the DUOX2 gene: c.650A>G, which is new variant of uncertain clinical significance. The clinical manifestations and genetic testing of patients can help diagnose Rafiq syndrome. To the best of our knowledge, this combination of genetic defects is unique and has not been previously reported in the literature.

Pendred syndrome (PDS) is an autosomal recessive disease caused by variants in SLC26A4 manifesting thyroid dyshormonogenesis. Patients typically present with goiter and sensorineural hearing loss (SNHL). The prevalence of PDS in non-African populations is estimated to be between 7.5 and 10 per 100,000, while its occurrence in African populations has not been reported with molecular analysis. This study, conducted at a university research center in Miami, USA and Khartoum, Sudan, to investigate PDS in Sudanese families with congenital hypothyroidism (CH). It involved 32 Sudanese families with children diagnosed with CH between 2016 and 2023. Patients underwent clinical evaluation, thyroid function tests, and genetic sequencing. Two disease-causing SLC26A4 variants were identified in two consanguineous families with first-cousin parents. One homozygous nonsense variant causing premature termination, p.Trp482*, previously reported as part of a compound heterozygous defect together with p.Gly102Arg, while the other homozygous defect was a previously reported missense variant, p.Thr410Met. In 32 families (72 individuals) whole exome sequencing data revealed 56.3% of families or 45.8% individuals harbored the SLC26A4 variants either in hetero or homozygous state. Of the 33 subjects who tested positive for the variants, 12 (36.4%) harbored more than one SLC26A4 variant. This report extends our understanding of the severity of the phenotypes caused by deleterious bi-allelic variants in SLC26A4. Recurrent SLC26A4 variants observed in our cohort likely reflect high consanguinity rather than a founder effect. SLC26A4 screening could be a part of the molecular testing for children presenting with congenital or early-onset SNHL in Sudan. The online version contains supplementary material available at 10.1007/s12020-025-04423-4.