Tipo de hipotireoidismo congênito primário, uma deficiência permanente do hormônio tireoidiano que está presente desde o nascimento e resulta de erros inatos na síntese do hormônio tireoidiano.
Introdução
O que você precisa saber de cara
Tipo de hipotireoidismo congênito primário, uma deficiência permanente do hormônio tireoidiano que está presente desde o nascimento e resulta de erros inatos na síntese do hormônio tireoidiano.
Escala de raridade
<1/50kMuito rara
1/20kRara
1/10kPouco freq.
1/5kIncomum
1/2k
Encontrou um erro ou informação desatualizada? Sugira uma correção →
Entender a doença
Do básico ao detalhe, leia no seu ritmo
Preparando trilha educativa...
Sinais e sintomas
O que aparece no corpo e com que frequência cada sintoma acontece
Partes do corpo afetadas
+ 23 sintomas em outras categorias
Características mais comuns
Os sintomas variam de pessoa para pessoa. Abaixo estão as 46 características clínicas mais associadas, ordenadas por frequência.
Linha do tempo da pesquisa
Encontrou um erro ou informação desatualizada? Sugira uma correção →
Genética e causas
O que está alterado no DNA e como passa nas famílias
Genes associados
6 genes identificados com associação a esta condição. Padrão de herança: Autosomal recessive.
Generates hydrogen peroxide which is required for the activity of thyroid peroxidase/TPO and lactoperoxidase/LPO (PubMed:15972824). Plays a role in thyroid hormone synthesis. Also required for lactoperoxidase-mediated antimicrobial defense at the surface of mucosa (PubMed:12824283). Synthesizes NAADP from its reduced NAADPH form which promotes Ca(2+) signaling during T cell activation (PubMed:34784249). May have its own peroxidase activity through its N-terminal peroxidase-like domain
Apical cell membraneCell junction
Thyroid dyshormonogenesis 6
A disorder due to a defective conversion of accumulated iodide to organically bound iodine. The iodide organification defect can be partial or complete.
Catalyzes the dehalogenation of halotyrosines such as 3-bromo-L-tyrosine, 3-chloro-L-tyrosine, 3-iodo-L-tyrosine and 3,5-diiodo-L-tyrosine (PubMed:15289438, PubMed:18434651, PubMed:25395621, PubMed:28157283). During thyroid hormone biosynthesis, facilitates iodide salvage by catalysing the oxidative NADPH-dependent deiodination of the halogenated by-products of thyroid hormone production, monoiodotyrosine (L-MIT) and diiodotyrosine (L-DIT) (PubMed:15289438, PubMed:18434651). The scavanged iodide
Cell membraneCytoplasmic vesicle membrane
Thyroid dyshormonogenesis 4
A disorder due to thyroid dyshormonogenesis, causing severe hypothyroidism, goiter, excessive levels of iodotyrosine in serum and urine, and variable mental deficits derived from unrecognized and untreated hypothyroidism.
Sodium:iodide symporter that mediates the transport of iodide into the thyroid gland (PubMed:12488351, PubMed:18372236, PubMed:18708479, PubMed:20797386, PubMed:31310151, PubMed:32084174, PubMed:8806637, PubMed:9329364). Can also mediate the transport of chlorate, thiocynate, nitrate and selenocynate (PubMed:12488351)
Cell membraneCytoplasm
Thyroid dyshormonogenesis 1
A disorder characterized by the inability of the thyroid to maintain a concentration difference of readily exchangeable iodine between the plasma and the thyroid gland, leading to congenital hypothyroidism.
Iodination and coupling of the hormonogenic tyrosines in thyroglobulin to yield the thyroid hormones T(3) and T(4)
MembraneCell surface
Acts as a substrate for the production of iodinated thyroid hormones thyroxine (T4) and triiodothyronine (T3) (PubMed:17532758, PubMed:32025030). The synthesis of T3 and T4 involves iodination of selected tyrosine residues of TG/thyroglobulin followed by their oxidative coupling in the thyroid follicle lumen (PubMed:32025030). Following TG re-internalization and lysosomal-mediated proteolysis, T3 and T4 are released from the polypeptide backbone leading to their secretion into the bloodstream (P
Secreted
Thyroid dyshormonogenesis 3
A disorder due to thyroid dyshormonogenesis, causing large goiters of elastic and soft consistency in the majority of patients. Although the degree of thyroid dysfunction varies considerably among patients with defective thyroglobulin synthesis, patients usually have a relatively high serum free triiodothyronine (T3) concentration with disproportionately low free tetraiodothyronine (T4) level. The maintenance of relatively high free T3 levels prevents profound tissue hypothyroidism except in brain and pituitary, which are dependent on T4 supply, resulting in neurologic and intellectual defects in some cases.
Required for the maturation and transport of functional DUOX2 from the endoplasmic reticulum to the plasma membrane (PubMed:16651268). Recruits DUOX2 to the apical cell membrane (PubMed:39126279)
Endoplasmic reticulum membraneApical cell membrane
Thyroid dyshormonogenesis 5
A disorder due to thyroid dyshormonogenesis, causing hypothyroidism, goiter, and variable mental deficits derived from unrecognized and untreated hypothyroidism.
Variantes genéticas (ClinVar)
480 variantes patogênicas registradas no ClinVar.
Classificação de variantes (ClinVar)
Distribuição de 19 variantes classificadas pelo ClinVar.
Vias biológicas (Reactome)
13 vias biológicas associadas aos genes desta condição.
Diagnóstico
Os sinais que médicos procuram e os exames que confirmam
Tratamento e manejo
Remédios, cuidados de apoio e o que precisa acompanhar
Onde tratar no SUS
Hospitais de referência no Brasil e o protocolo oficial do SUS (PCDT)
🇧🇷 Atendimento SUS — Dishormonogênese da tireoide familiar
Selecione um estado ou use sua localização para ver resultados.
Dados de DATASUS/CNES, SBGM, ABNeuro e Ministério da Saúde. Sempre confirme a disponibilidade diretamente com o estabelecimento.
Pesquisa ativa
Ensaios clínicos abertos e novidades científicas recentes
Ensaios em destaque
🟢 Recrutando agora
1 pesquisa recrutando participantes. Converse com seu médico sobre a possibilidade de participar.
Outros ensaios clínicos
Publicações mais relevantes
Finnish-Enriched SLC26A7 Variant in Congenital Hypothyroidism: Clinical Spectrum, Thyroid Histopathology, and Expression Analysis.
Defects in thyroid hormone synthesis at birth lead to congenital hypothyroidism (CH). Recently, pathogenic variants in the SLC26A7 gene have been linked to dyshormonogenetic goitrous CH. This anion transporter is highly expressed in the thyroid and is involved in thyroid hormone synthesis; however, its exact function and cellular localization remain unclear. In this study, we investigated SLC26A7 variants in Finnish patients with CH, characterized the phenotypes, and analyzed thyroid-specific gene expression. SLC26A7 variants were identified from a clinical CH cohort (n = 139) using exome sequencing, and the FinnGen database (R12 release) was screened for disease associations. Thyroid histology and thyroid-specific gene expression were analyzed in six human samples (including two homozygous SLC26A7 pathogenic variant carriers, patients with goitrous and hyperactive thyroids, and normal controls) and in thyroids from different mouse models (including hypo- and hyperthyroid mice, thyroid-specific G-protein deficient, and Slc26a7-knockout mice). Four CH patients from four novel families carried the homozygous SLC26A7 (c.1893delT, p.F631Lfs*8) pathogenic variant. Two had large trachea-compressing goiters, requiring thyroidectomy already at birth. In addition, one homozygous participant with normal CH screening results developed hypothyroidism at age 16, and one patient with heterozygous SLC26A7 pathogenic variant had permanent CH at birth. Dentofacial abnormalities were frequently noted, including enamel hypoplasia (in four carriers), pro- or retrognathia, and malocclusion requiring orthodontic treatment (in 8/24 carriers). Thyrocyte hypertrophy with large colloid aggregates was a hallmark of homozygous patients. FinnGen screening revealed a 75-fold enrichment of the variant in the Finnish population, identifying a few other homozygous and seven heterozygous cases with early-onset hypothyroidism and dentofacial abnormalities. In human thyrocytes, SLC26A7 was localized to the basolateral membrane, with intense staining in hyperthyroid samples, while in mouse thyroid models, its expression pattern depended on dietary iodide levels, thyrotropin signaling, and GNAS activity. We describe variable phenotypes associated with the SLC26A7 pathogenic variant, ranging from severe CH with large congenital goiters to delayed onset hypothyroidism and dentofacial abnormalities. SLC26A7 shows thyrotropin-, GNAS-, and dietary iodine-dependent basolateral localization, suggesting their role in phenotypic variations.
Functional Domain Mapping of TPO: Insights From 6 Variants in Sudanese Kindreds With Congenital Hypothyroidism.
Congenital hypothyroidism (CH) is a leading cause of preventable intellectual disability worldwide if left untreated. Thyroid peroxidase (TPO) is a key enzyme that uses hydrogen peroxide from the DUOX/DUOXA system to oxidize iodide for thyroid hormone synthesis. This work aimed to identify the pathogenic TPO variants responsible for CH. Variants identified by whole-exome sequencing were analyzed using in silico tools and structural modeling for pathogenicity. TPO function was assessed through in vitro studies on intracellular trafficking, enzymatic activity, and interaction with DUOX/DUOXA proteins. Six TPO variants were identified: p.G395D, p.V618M, p.M706V, and p.T725P in family 1, and p.R648G and p.G771R in families 2 and 3, respectively. Affected individuals in family 1 exhibited compound heterozygous or homozygous variants for the 4 variants. In silico analyses showed incomplete concordance in predicting pathogenicity. In vitro studies confirmed p.G395D as the primary pathogenic variant in family 1, and p.R648G and p.G771R in families 2 and 3. Notably, p.V618M, p.M706V, and p.T725P did not impair TPO function, either individually or in combination, suggesting that these regions are not critical for enzymatic activity. Further functional analyses revealed that p.G771R is essential for proper membrane insertion, whereas p.R648G is necessary for enzymatic activity. When multiple TPO variants occur within the same family, a combination of in silico and in vitro analyses can help identify the variant responsible for the phenotype. In silico methods, however, cannot predict the different mechanisms of impairment, such as enzyme activity vs cellular localization, where the protein's topology is essential for normal function.
Genetic Analyses in a Cohort of Pediatric Patients with Congenital Hypothyroidism Based on Congenital Hypothyroidism Consensus Guideline.
Pathogenic variants in the genes involved in the formation of thyroid tissue and thyroid hormone secretion have been reported to cause congenital hypothyroidism (CH) in some cases. This study aimed to evaluate the clinical and genetic findings of CH cases thought to be due to genetic variants. The study included cases whose genetic analysis was performed in accordance with the Congenital Hypothyroidism: A 2020-2021 Consensus Guidelines Update Guidelines recommendations criteria and analyzed them using the next-generation sequencing panel. Sixty one Turkish patients from 45 families were included in the study. The overall frequency of variant detection was 37.7% (out of 45 families, 17 had a positive mutation). Segregation was carried out for all families with positive variants. Variants in the TPO gene are the most frequently encountered, and this situation was identified in 10 families. Variants followed this in the TSHR gene in 7 families, variants in the DUOX2 gene in 5 families, and two variants in the TG and NKX2-1 genes in 2 families each, which are six novel variants. Furthermore, among the NKX2-1 cases, one had thyroid involvement only, while the other had chorea only. We did not find differences between cases with detected mutations and mutation-negative cases regarding gender, neonatal/perinatal parameters, initial thyroid function values, and thyroid morphology. In the current investigation, rare new variations in genes known to be related to CH were discovered, adding to the molecular genetic spectrum. When we compare the overall variant detection frequency, the selection criterion for genetic analysis based on the current guidelines is quite rational, considering the benefits and costs, on the other hand, present in new genes awaiting discovery. Also, TSHR mutations are likely to be common and may account for more than 5% of thyroid dysgenesis cases if we include nonfamilial thyroid dysgenesis.
A new case of Rafiq syndrome with coexisting thyroid dyshormonogenesis type 6 in a Chinese patient: case report and literature review.
Rafiq syndrome is a rare autosomal recessive genetic disorder first described by Rafiq et al. in 2011.With an extremely low incidence rate, just over 40 cases have been reported worldwide. This condition is caused by mutations in the MAN1B1 gene, which encodes a member of the glycosyl hydrolase family 47.The primary clinical features of Rafiq syndrome include intellectual and motor developmental delay, distinctive facial features, truncal obesity, and hypotonia. We described a case of Rafiq syndrome with coexisting thyroid dyshormonogenesis type 6 in a Chinese Patient. The patient presented with distinctive facial features (small forehead, wide eye distance, small bilateral eye fissures, low nose bridge, protruding nose, short philtrum, small chin, large ears, short neck), borderline intellectual delay, truncal obesity, abnormal coagulation function, abnormal electroencephalogram, which were similar with the clinical manifestations of Rafiq syndrome reported in the literature. In addition to the above-mentioned abnormalities, the child also has thyroid dyshormonogenesis type 6. Genetic testing has identified compound heterozygous mutations in the MAN1B1 gene: c.1281_1303delCATCCACGCCTGTGTCTGGAAGA and c.2011C>T, and one heterozygous mutation in the DUOX2 gene: c.650A>G, which is new variant of uncertain clinical significance. The clinical manifestations and genetic testing of patients can help diagnose Rafiq syndrome. To the best of our knowledge, this combination of genetic defects is unique and has not been previously reported in the literature.
Prevalence of pendrin defects in sudanese families with congenital hypothyroidism.
Pendred syndrome (PDS) is an autosomal recessive disease caused by variants in SLC26A4 manifesting thyroid dyshormonogenesis. Patients typically present with goiter and sensorineural hearing loss (SNHL). The prevalence of PDS in non-African populations is estimated to be between 7.5 and 10 per 100,000, while its occurrence in African populations has not been reported with molecular analysis. This study, conducted at a university research center in Miami, USA and Khartoum, Sudan, to investigate PDS in Sudanese families with congenital hypothyroidism (CH). It involved 32 Sudanese families with children diagnosed with CH between 2016 and 2023. Patients underwent clinical evaluation, thyroid function tests, and genetic sequencing. Two disease-causing SLC26A4 variants were identified in two consanguineous families with first-cousin parents. One homozygous nonsense variant causing premature termination, p.Trp482*, previously reported as part of a compound heterozygous defect together with p.Gly102Arg, while the other homozygous defect was a previously reported missense variant, p.Thr410Met. In 32 families (72 individuals) whole exome sequencing data revealed 56.3% of families or 45.8% individuals harbored the SLC26A4 variants either in hetero or homozygous state. Of the 33 subjects who tested positive for the variants, 12 (36.4%) harbored more than one SLC26A4 variant. This report extends our understanding of the severity of the phenotypes caused by deleterious bi-allelic variants in SLC26A4. Recurrent SLC26A4 variants observed in our cohort likely reflect high consanguinity rather than a founder effect. SLC26A4 screening could be a part of the molecular testing for children presenting with congenital or early-onset SNHL in Sudan. The online version contains supplementary material available at 10.1007/s12020-025-04423-4.
Publicações recentes
Early Familial Non-Medullary Thyroid Cancer: Differences with Late-Onset and Sporadic Forms.
CTLA4, PTNP22, and FOXO3A gene variants as genetic biomarkers for co-occurrence of type 1 diabetes and autoimmune thyroid diseases in the Polish population.
Unmasking familial follicular cell-derived thyroid neoplasms associated with syndromes: DICER1 and PTEN-hamartoma tumor syndromes.
Maternal Thyroid Hormone Evaluation in Women With Gestational Diabetes Mellitus in the Second Trimester.
Thyroid Hemiagenesis: A Longitudinal Case Report of Dynamic Thyroid Function.
📚 EuropePMCmostrando 60
Finnish-Enriched SLC26A7 Variant in Congenital Hypothyroidism: Clinical Spectrum, Thyroid Histopathology, and Expression Analysis.
Thyroid : official journal of the American Thyroid AssociationA new case of Rafiq syndrome with coexisting thyroid dyshormonogenesis type 6 in a Chinese patient: case report and literature review.
Frontiers in endocrinologyFunctional Domain Mapping of TPO: Insights From 6 Variants in Sudanese Kindreds With Congenital Hypothyroidism.
The Journal of clinical endocrinology and metabolismPrevalence of pendrin defects in sudanese families with congenital hypothyroidism.
EndocrinePermanent Congenital Hypothyroidism due to Rare Thyroglobulin Gene Variant (p.Cys1476Arg): A Delayed Diagnosis of Thyroid Dyshormonogenesis.
Case reports in medicine[Genetic analysis of a fetus pedigree affected with Thyroid dyshormonogenesis type 5 combined with familial Neurofibromatosis type 1].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical geneticsCommon and Rare DUOX Variants in Patients With Congenital Hypothyroidism: Case-control Study and Family-based Analysis.
The Journal of clinical endocrinology and metabolismTwo Novel SLC5A5 Variants (Q263L and G350D) Causing Congenital Hypothyroidism.
Thyroid : official journal of the American Thyroid AssociationGenetic Analyses in a Cohort of Pediatric Patients with Congenital Hypothyroidism Based on Congenital Hypothyroidism Consensus Guideline.
Hormone research in paediatricsFrequency of Mutations in the TPO Gene in Patients with Congenital Hypothyroidism Due to Dyshormonogenesis in Chile.
Medicina (Kaunas, Lithuania)Clinical and molecular study of patients with thyroid dyshormogenesis and variants in the thyroglobulin gene.
Frontiers in endocrinologyFunctional Characterization of Thyroid Peroxidase Missense Variants Causing Thyroid Dyshormonogenesis in Asian Indian Population.
Hormone research in paediatricsOutcomes of lowered newborn screening thresholds for congenital hypothyroidism.
Journal of paediatrics and child healthPathogenic variations in MAML2 and MAMLD1 contribute to congenital hypothyroidism due to dyshormonogenesis by regulating the Notch signalling pathway.
Journal of medical geneticsThe p.Pro2232Leu variant in the ChEL domain of thyroglobulin gene causes intracellular transport disorder and congenital hypothyroidism.
EndocrineAssociation of recessive c.430G>A (p.(Gly144Arg)) thyroid peroxidase variant with primary congenital hypothyroidism in cats.
Journal of veterinary internal medicineMutational screening of the TPO and DUOX2 genes in Argentinian children with congenital hypothyroidism due to thyroid dyshormonogenesis.
EndocrineClinical characteristics and genetics analysis for the ITD of congenital hypothyroidism.
Journal of pediatric endocrinology & metabolism : JPEMScreening of 23 candidate genes by next-generation sequencing of patients with permanent congenital hypothyroidism: novel variants in TG, TSHR, DUOX2, FOXE1, and SLC26A7.
Journal of endocrinological investigationInsights of Noncanonical Splice-site Variants on RNA Splicing in Patients With Congenital Hypothyroidism.
The Journal of clinical endocrinology and metabolismFunctions of the Thyroid-Stimulating Hormone on Key Developmental Features Revealed in a Series of Zebrafish Dyshormonogenesis Models.
CellsThe mutation screening in candidate genes related to thyroid dysgenesis by targeted next-generation sequencing panel in the Chinese congenital hypothyroidism.
Clinical endocrinologyNext-Generation Sequencing Analysis Reveals Frequent Familial Origin and Oligogenism in Congenital Hypothyroidism With Dyshormonogenesis.
Frontiers in endocrinologyStructure and genetic variants of thyroglobulin: Pathophysiological implications.
Molecular and cellular endocrinologyGenetic Evaluation of Congenital Hypothyroidism with Gland in situ Using Targeted Exome Sequencing.
Annals of clinical and laboratory scienceGenetics of primary congenital hypothyroidism-a review.
Hormones (Athens, Greece)DUOX2 variants are a frequent cause of congenital primary hypothyroidism in Thai patients.
Endocrine connectionsCongenital Hypothyroidism: A 2020-2021 Consensus Guidelines Update-An ENDO-European Reference Network Initiative Endorsed by the European Society for Pediatric Endocrinology and the European Society for Endocrinology.
Thyroid : official journal of the American Thyroid AssociationPhenotypic Variability of Patients With PAX8 Variants Presenting With Congenital Hypothyroidism and Eutopic Thyroid.
The Journal of clinical endocrinology and metabolismIdentification and analyzes of DUOX2 mutations in two familial congenital hypothyroidism cases.
EndocrineGenetics of Gland-in-situ or Hypoplastic Congenital Hypothyroidism in Macedonia.
Frontiers in endocrinologyAnaplastic Thyroid Cancer Arising from Dyshormonogenetic Goiter: c.3070T>C and Novel c.7070T>C Mutation in the Thyroglobulin Gene.
Thyroid : official journal of the American Thyroid AssociationA Novel Homozygous Mutation in the Solute Carrier Family 26 Member 7 Gene Causes Thyroid Dyshormonogenesis in a Girl with Congenital Hypothyroidism.
Thyroid : official journal of the American Thyroid AssociationIncreased Prevalence of TG and TPO Mutations in Sudanese Children With Congenital Hypothyroidism.
The Journal of clinical endocrinology and metabolismGenetic analyses in a cohort of Portuguese pediatric patients with congenital hypothyroidism.
Journal of pediatric endocrinology & metabolism : JPEMRelevance of solute carrier family 5 transporter defects to inherited and acquired human disease.
Journal of applied geneticsNovel Sodium/Iodide Symporter Compound Heterozygous Pathogenic Variants Causing Dyshormonogenic Congenital Hypothyroidism.
Thyroid : official journal of the American Thyroid AssociationGenetics and management of congenital hypothyroidism.
Best practice & research. Clinical endocrinology & metabolismThyroid Hypoplasia in Congenital Hypothyroidism Associated with Thyroid Peroxidase Mutations.
Thyroid : official journal of the American Thyroid AssociationThe genetic characteristics of congenital hypothyroidism in China by comprehensive screening of 21 candidate genes.
European journal of endocrinologyMolecular Analysis of Congenital Hypothyroidism in Saudi Arabia: SLC26A7 Mutation Is a Novel Defect in Thyroid Dyshormonogenesis.
The Journal of clinical endocrinology and metabolismCongenital Hypothyroidism Due to Dyshormonogenesis in 2 Siblings.
Indian journal of pediatricsMolecular analysis of thyroglobulin mutations found in patients with goiter and hypothyroidism.
Molecular and cellular endocrinologyDisorders of H2O2 generation.
Best practice & research. Clinical endocrinology & metabolismIodide handling disorders (NIS, TPO, TG, IYD).
Best practice & research. Clinical endocrinology & metabolismIntrauterine death following intraamniotic triiodothyronine and thyroxine therapy for fetal goitrous hypothyroidism associated with polyhydramnios and caused by a thyroglobulin mutation.
Endocrinology, diabetes & metabolism case reportsDefects of Thyroid Hormone Synthesis and Action.
Endocrinology and metabolism clinics of North AmericaGenotype-phenotype correlations of dyshormonogenetic goiter in children and adolescents from South India.
Indian journal of endocrinology and metabolismDUOX2 Gene Mutation Manifesting as Resistance to Thyrotropin Phenotype.
Thyroid : official journal of the American Thyroid AssociationMutations in the genes for thyroglobulin and thyroid peroxidase cause thyroid dyshormonogenesis and autosomal-recessive intellectual disability.
Journal of human geneticsA Homozygous TPO Gene Duplication (c.1184_1187dup4) Causes Congenital Hypothyroidism in Three Siblings Born to a Consanguineous Family.
Journal of pediatric geneticsBiochemical, radiological, and genetic characterization of congenital hypothyroidism in Abu Dhabi, United Arab Emirates.
Journal of pediatric endocrinology & metabolism : JPEMPrevalence of Thyroid Disorders in Children at a Tertiary Care Hospital in Western India.
Journal of clinical and diagnostic research : JCDRPendred Syndrome in a Newborn with Neck Swelling: A Case Report.
Journal of tropical pediatricsCongenital hypothyroidism and thyroid dyshormonogenesis: a case report of siblings with a newly identified mutation in thyroperoxidase.
Journal of pediatric endocrinology & metabolism : JPEMThe Missense Alteration A5T of the Thyroid Peroxidase Gene is Pathogenic and Associated with Mild Congenital Hypothyroidism.
Journal of clinical research in pediatric endocrinologyA Novel Mutation in Thyroid Peroxidase Gene Causing Congenital Goitrous Hypothyroidism in a German-Thai Patient.
Journal of clinical research in pediatric endocrinologySegregation of S292F TPO gene mutation in three large Tunisian families with thyroid dyshormonogenesis: evidence of a founder effect.
European journal of pediatricsNovel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.
Molecular and cellular endocrinologyPrevalence of c.2268dup and detection of two novel alterations, c.670_672del and c.1186C>T, in the TPO gene in a cohort of Malaysian-Chinese with thyroid dyshormonogenesis.
BMJ openAssociações
Organizações que acompanham esta doença — pra ter apoio e orientação
Ainda não temos associações cadastradas para Dishormonogênese da tireoide familiar.
É de uma associação que acompanha esta doença? Fale com a gente →
Comunidades
Grupos ativos de quem convive com esta doença aqui no Raras
Ainda não existe comunidade no Raras para Dishormonogênese da tireoide familiar
Pacientes, familiares e cuidadores se organizam em comunidades pra compartilhar experiências, fazer perguntas e se apoiar. Você pode ser o primeiro.
Tire suas dúvidas
Perguntas, dicas e experiências compartilhadas aqui na página
Participe da discussão
Faça login para postar dúvidas, compartilhar experiências e interagir com especialistas.
Fazer loginDoenças relacionadas
Doenças com sintomas parecidos — ajudam quem ainda está buscando diagnóstico
Referências e fontes
Bases de dados externas citadas neste artigo
Publicações científicas
Artigos indexados no PubMed ligados a esta doença no grafo RarasNet — título, periódico e PMID direto da fonte, sem intermediação de IA.
- Finnish-Enriched SLC26A7 Variant in Congenital Hypothyroidism: Clinical Spectrum, Thyroid Histopathology, and Expression Analysis.
- Functional Domain Mapping of TPO: Insights From 6 Variants in Sudanese Kindreds With Congenital Hypothyroidism.
- Genetic Analyses in a Cohort of Pediatric Patients with Congenital Hypothyroidism Based on Congenital Hypothyroidism Consensus Guideline.
- A new case of Rafiq syndrome with coexisting thyroid dyshormonogenesis type 6 in a Chinese patient: case report and literature review.
- Prevalence of pendrin defects in sudanese families with congenital hypothyroidism.
- Early Familial Non-Medullary Thyroid Cancer: Differences with Late-Onset and Sporadic Forms.
- CTLA4, PTNP22, and FOXO3A gene variants as genetic biomarkers for co-occurrence of type 1 diabetes and autoimmune thyroid diseases in the Polish population.
- Unmasking familial follicular cell-derived thyroid neoplasms associated with syndromes: DICER1 and PTEN-hamartoma tumor syndromes.
- Maternal Thyroid Hormone Evaluation in Women With Gestational Diabetes Mellitus in the Second Trimester.
- Thyroid Hemiagenesis: A Longitudinal Case Report of Dynamic Thyroid Function.
Bases de dados e fontes oficiais
Identificadores e referências canônicas usadas para montar este verbete.
- ORPHA:95716(Orphanet)
- MONDO:0010132(MONDO)
- GARD:16843(GARD (NIH))
- Variantes catalogadas(ClinVar)
- Busca completa no PubMed(PubMed)
- Q7799748(Wikidata)
Dados compilados pelo RarasNet a partir de fontes abertas (Orphanet, OMIM, MONDO, PubMed/EuropePMC, ClinicalTrials.gov, DATASUS, PCDT/MS). Este conteúdo é informativo e não substitui avaliação médica.
Conteúdo mantido por Agente Raras · Médicos e pesquisadores podem colaborar

Dishormonogênese da tireoide familiar
📋 Origem dos dados
Esta página agrega dados de fontes públicas e oficiais. Dados sobre cobertura no SUS (PCDT, CEAF) são verificados ativamente por agente proativo (ver badge no infobox). Demais dados têm atribuição de fonte + data da última sincronização — clique para abrir o original.
- Doença rara (ontologia)
- fonte: Orphanet
- Identificador unificado
- fonte: MONDO
- Codificação WHO/SUS
- fonte: WHO ICD-10 / DATASUS
- CID-11 (futuro)
- fonte: WHO ICD-11
- NIH/GARD
- fonte: GARD (NIH)
- Indexação biomédica
- fonte: MeSH (NLM)
- Dado público estruturado
- fonte: Wikidata