Aniridia is an autosomal dominant condition characterized by the complete or partial absence of the iris, often with additional presentations such as foveal hypoplasia, nystagmus, cataract, glaucoma and other ocular abnormalities. Most cases are caused by heterozygous mutations in the paired box 6 gene (PAX6), which codes for a transcription factor that regulates eye development. Four patients from our hospital who presented with ocular phenotypes were recruited for research sequencing with informed consent. Sanger sequencing of PAX6 coding exons or exome sequencing was performed on genomic DNA from venous blood samples. Variants in PAX6 were identified in the four patients. Two variants are recurrent single-nucleotide substitutions - one is a substitution found in a patient with bilateral aniridia, whereas the other is a splice variant in a patient with nystagmus and neuroblastoma. The other two variants are novel and found in two patients with isolated aniridia. Both are small duplications that are predicted to lead to premature termination. For the recurrent variants, the comparison of phenotypes for patients with identical variants would shed light on the mechanisms of pathogenesis, and the discovery of two novel variants expands the spectrum of PAX6 mutations.

Aniridia, which is a rare congenital defect of the eye, consists of iris hypoplasia or aplasia, and additional ocular abnormalities. It is most commonly caused by autosomal dominant PAX6 gene mutations. However, in about 30% of cases, it is associated with chromosomal rearrangements in the 11p13 region. The aim of this study was to identify the potential PAX6 gene variants, which could cause the isolated aniridia. Eight patients with isolated aniridia were included in this study. MLPA analysis allowed in the past to exclude large structural rearrangements of the PAX6 and adjacent genes like WT1. Blood samples were collected from the patients (and their families in familial cases) and genomic DNA was extracted from peripheral blood leukocytes and buccal cells. The amplification of the 11 exons of the PAX6 gene was performed. Bidirectional Sanger Sequencing was conducted for the identification of the potentially pathogenic variants, and for the segregation analysis of the identified variant in the family. The results were analyzed with the use of CodonCode Aligner software. In three patients, aniridia was sporadic, whereas in another five cases, the eye defect was familial. The potentially pathogenic variants in the PAX6 gene were found in 6 out of 8 patients with aniridia. We identified four known (c.781C > T, c.607C > T, and c.949C > T twice), and two novel variants (c.258_265del and c.495_496insG). Point mutations in the PAX6 gene are the most frequent cause of aniridia. The investigation of the genetic background of the disease is essential for patients to evaluate recurrence risk in the offspring.

Mutations in PAX6 gene (chromosome 11p13) encoding a transcriptional regulator involved in oculogenesis mostly present with aniridia. Aniridia is not uncommon in the Philippines but only limited information is available as yet. The purpose of this study was to present a novel, deletion mediated by complex rearrangement in PAX6 gene causing an isolated aniridia in a Filipino girl. The patient is an 8-year-old girl who came in due to leukocoria with associated nystagmus and esotropia. She presented with subnormal vision, nystagmus, aniridia, and cataractous lenses in both eyes. The family history reveals presence of the aniridia and cataract with the mother and a sibling. The patient underwent lens extraction without intraocular lens implantation bilaterally, where patient subsequently underwent intraocular lens implantation on her left eye. Systemic workup was performed including whole abdomen, renal ultrasound, blood chemistry, and urinalysis. Targeted cataract panel with WT1 and PAX6 genes revealed a novel, heterozygous PAX6-inherited mutation from the mother. This variant is a complex rearrangement in PAX6 involving partial deletions of exons 3-5, including the initiator codon. Deletions of PAX6 are part of a contiguous gene deletion syndrome - Wilms tumor, aniridia, genitourinary anomalies, and intellectual disability syndrome - and therefore evaluation of the WT1 gene was necessary to rule out this life-threatening syndrome. This rare, complex rearrangement of multiple exons and deletions in PAX6 causing an isolated aniridia phenotype is probably the first reported case. The patient was managed by a multidisciplinary team and the guardians were counseled regarding the prognosis and complications.

Aniridia is usually an autosomal dominant, rare disorder characterized by a variable degree of hypoplasia or the absence of iris tissue, with additional ocular abnormalities. Pathogenic variants in the PAX6 gene are associated with aniridia in most patients. However, in up to 30% of individuals, disease results from 11p13 chromosomal rearrangements. Here we present a patient with a clinical diagnosis of partial aniridia born to consanguineous Polish parents. The parents were asymptomatic and ophthalmologically normal. We performed PAX6 sequencing, array comparative genomic hybridization, quantitative real-time PCR, and whole genome sequencing. aCGH revealed a homozygous deletion of the DCDC1 gene fragment in the patient. The same, but heterozygous deletion, was detected in each of the patient's asymptomatic parents and brother. In the presented family, the signs and symptoms of aniridia are observed only in the homozygous proband. Whole genome sequencing analysis was performed to determine other possible causes of the disease and did not detect any additional or alternative potentially pathogenic variant. We report a novel homozygous deletion located in the 11p13 region, which does not include the PAX6 gene or any known PAX6 enhancers. To our best knowledge, this is the first reported case of a patient presented with isolated aniridia carrying a homozygous microdeletion downstream of the PAX6 gene.

Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6. Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression. All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD). To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.