HOXD13 is an important regulator of limb development. Pathogenic variants in HOXD13 cause synpolydactyly type 1 (SPD1). How different types and positions of HOXD13 variants contribute to genotype-phenotype correlations, penetrance, and expressivity of SPD1 remains elusive. Here, we present a novel cohort and a literature review to elucidate HOXD13 phenotype-genotype correlations. Patients with limb anomalies suggestive of SPD1 were selected for analysis of HOXD13 by Sanger sequencing, repeat length analysis, and next-generation sequencing. Literature was reviewed for HOXD13 heterozygotes. Variants were annotated for phenotypic data. Severity was calculated, and cluster and decision-tree analyses were performed. We identified 98 affected members of 38 families featuring 11 different (likely) causative variants and 4 variants of uncertain significance. The most frequent (25/38) were alanine repeat expansions. Phenotypes ranged from unaffected heterozygotes to severe osseous synpolydactyly, with intra- and inter-familial heterogeneity and asymmetry. A literature review provided 160 evaluable affected members of 49 families with SPD1. Computer-aided analysis only corroborated a positive correlation between alanine repeat length and phenotype severity. Our findings support that HOXD13-protein condensation in addition to haploinsufficiency is the molecular pathomechanism of SPD1. Our data may, also, facilitate the interpretation of synpolydactyly radiographs by future automated tools.

Synpolydactyly type 1 (SPD1, OMIM 186000) is inherited as autosomal dominant and is caused by HOXD13 mutations. The condition is rare and is known for its phenotypic heterogeneity. In the homozygous state, the phenotype is generally more severe and is characterized by three main features: a more severe degree of syndactyly, a more severe degree of brachydactyly, and the frequent loss of the normal tubular shape of the metacarpals/metatarsals. Due to the phenotypic heterogeneity and the phenotypic overlap with other types of syndactyly, no pathognomonic feature has been described for the homozygous phenotype of SPD1. In the current communication, the author reviews the literature on the phenotypes of SPD1 in homozygous patients. The review documents that not all homozygous patients show a severe hand phenotype. The review also defines the "relatively long and medially deviated big toe with/without cupping of the forefoot" as a pathognomonic feature in the phenotype. Illustration of this feature is done through a demonstrative clinical report in a multigeneration family with SPD1 and HOXD13 polyalanine repeat expansion. Finally, the pathogenesis of the clinical features is reviewed.

Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.