Oculocutaneous albinism (OCA) is a condition inherited in an autosomal recessive manner, leading to reduced pigmentation in the skin, hair, and eyes. Oculocutaneous albinism type 2 (OCA2) is one of the most common forms of OCA, caused by OCA2 mutations. This case report presents a newborn with suspected OCA. Postnatal examination revealed white skin, golden-colored hair, and reduced visibility of the retinal pigmented epithelium on fundus photography. Genomic DNA was extracted from the peripheral blood of the patient and her parents. Whole Exome Sequencing (WES) was conducted using chip capture-based high-throughput sequencing technology to analyze genomic DNA from the proband and her parents. Genetic variants of his parents were identified using sanger sequencing. A mutation in the OCA2 was identified: NM_000275.2: c.863_886delTGAGCAGGACCTTTGAGGTGA (p.Met288_Leu295del). Subsequently genetic analyses were conducted. This mutation was recognized as a potential disease-causing mutation, validating diagnosis of OCA2. Currently, few reports have been published regarding this mutation site. It represents a new mutation site in OCA2 (NM_000275.2:c.863_886del), contributing to the genetic diversity of the OCA2.

Oculocutaneous albinism type 2 (OCA-2, OMIM: 203200) is associated with variants in the OCA2 gene. In this study, we aimed to re-classify variants of uncertain significance (VUS) in OCA2 by evaluating subcellular localization and channel activity through multiplex assays of variant effect (MAVEs). Following the ClinGen guidelines for PS3 evidence, we selected 13 OCA2 variants from ClinVar (6 benign/likely benign [B/LB] and 7 pathogenic/likely pathogenic [P/LP]) for OddsPath analysis. The P/LP variants exhibited abnormal functions, while the B/LB variants demonstrated normal functions, supporting the application of "PS3_moderate" evidence for VUS re-classification. In our functional evaluation of 30 VUS identified in 38 individuals with suspected OCA-2 by trio whole-exome sequencing, we observed 6 VUS with abnormal localization and 11 with abnormal channel activity. Based on PS3_moderate evidence, 8 VUS were re-classified as LP, while 22 remained VUS. Consequently, 7 out of 38 previously undiagnosed patients received a molecular diagnosis of OCA-2. These MAVEs offer a robust approach for curating OCA2 VUS, enhancing diagnostic accuracy, and informing genetic counseling. Additionally, this variant cohort is a valuable resource for public databases.

Albinism is a rare genetic condition characterized by hypopigmentation of the skin, hair, and eyes, as well as visual impairments. Oculocutaneous albinism type 2 (OCA2) is commonly associated with variants in the OCA2 gene, which encodes a protein critical for melanosomal pH regulation and melanin biosynthesis. Exome sequencing, validated by Sanger sequencing, was employed to investigate the genetic basis of albinism in a consanguineous Iranian family. Bioinformatics analyses and structural modeling were conducted to assess the pathogenicity and impact of the detected variant. A 27-year-old male from a consanguineous Iranian family presented with features of oculocutaneous albinism, including white hair, blue eyes, strabismus, sun-sensitive skin, reduced visual acuity, and significant photophobia, resulting in functional limitations in bright environments. Genetic analysis identified a novel homozygous missense variant in the OCA2 gene, NM_000275.3:c.1274T>G (p.Met425Arg), located in exon 13. The genomic coordinates of the variant are chr15:g.27985154A>C (GRCh38/hg38). In silico tools classified the variant as likely pathogenic based on its evolutionary conservation, absence in population databases, and structural modeling predictions. Segregation analysis confirmed autosomal recessive inheritance, with both parents being heterozygous carriers. The identified OCA2 variant, c.1274T>G; p.Met425Arg, disrupts protein function, impairing melanosomal activity and melanin biosynthesis. This study underscores the importance of genetic analysis in characterizing OCA2 variants and highlights the need for further exploration of molecular mechanisms and phenotypic variability in OCA2-related albinism to improve diagnosis and counseling.

Guppies are small tropical fish with brightly colored bodies and variable tail shapes. There are two phenotypes of domestic guppy eye color: red and black. The wild type is black-eyed. The main object of this study was to identify candidate genes for the red-eyed phenotype in domestic guppies. We hope to provide molecular genetic information for the development of new domestic guppy strains. Additionally, the results also contribute to basic research concerning guppies. In this study, 121 domestic guppies were used for genomic analysis (GWAS), and 44 genes were identified. Furthermore, 21 domestic guppies were used for transcriptomic analysis, and 874 differentially expressed genes (DEGs) were identified, including 357 upregulated and 517 downregulated genes. Through GO and KEGG enrichment, we identified some important terms or pathways mainly related to melanin biosynthesis and ion transport. qRT-PCR was also performed to verify the differential expression levels of four important candidate genes (TYR, OCA2, SLC45A2, and SLC24A5) between red-eyed and black-eyed guppies. Based on the results of genomic and transcriptomic analyses, we propose that OCA2 is the most important candidate gene for the red-eyed phenotype in guppies.

To determine if visual maturation continues beyond the first decade of life in children with albinism and whether this is related to albinism type, presence of nystagmus, eye muscle surgery or refractive errors. Case series based on retrospective study of children with confirmed genetic diagnosis of albinism. Clinical data were obtained from medical files of children examined during school years, including albinism type, visual acuity, eye muscle surgery, nystagmus, and others on different visits (Visit 1: ages 7-9; Visit 2: ages: 10-12; Visit 3: ages 13-16; Visit 4: ages >16). Seventy-five children with albinism were included in the study. Patients were divided into different groups according to the albinism type including OCA1A: 17; OCA1B: 28; OCA2: 26; HPS: 3; OCA4: 1. Follow-up ranged from 3-13 years. Progressive visual acuity improvement was seen in all three main groups. T-test paired samples showed a statistically significant improvement when comparing vision from Visit 1 and Visit 3 in both OCA1A and OCA2 groups, with a mean vision improvement of 2 lines. There was no correlation between visual improvement and refractive error, eye muscle surgery or nystagmus. An improved visual performance was seen in a large percentage of children with albinism during the second decade of life. The reason for this late improvement in vision is not clear but may be related to late foveal maturation or improvement in nystagmus with time. This information is useful for clinicians of these patients and when counseling parents.